solved REVP finally

rust/src/solutions/revp.rs

@@ -1,3 +1,58 @@
-pub fn revp(file_content: String) -> String {
+use crate::utils::{get_dna_complement, read_fasta};
-    "placeholder".to_string()
+
+fn get_revps(dna: &str, complement: &str) -> Vec<usize> {
+    let mut out_vec: Vec<usize> = Vec::new();
+    for i in 4..dna.len() + 1 {
+        let sub_rev_comp: &String = &complement[..i].chars().rev().collect();
+        if sub_rev_comp == &dna[..i] {
+            out_vec.push(sub_rev_comp.len())
+        }
+    }
+    out_vec
+}
+
+pub fn revp(file_content: String) -> String {
+    let fastas = read_fasta(&file_content);
+    let fasta = &fastas[0];
+    let complement = get_dna_complement(&fasta.sequence);
+    let mut out_vec: Vec<String> = Vec::new();
+    let dna_len = fasta.sequence.len();
+
+    for position in 1..dna_len - 2 {
+        let mut last_pos = position + 11;
+        if last_pos > dna_len {
+            last_pos = dna_len;
+        }
+        let revps = get_revps(
+            &fasta.sequence[position - 1..last_pos],
+            &complement[position - 1..last_pos],
+        );
+        for r in revps.iter() {
+            out_vec.push(format!("{} {}", position, r));
+        }
+    }
+
+    return out_vec.join("\n");
+}
+
+#[cfg(test)]
+mod tests {
+    use super::*;
+
+    #[test]
+    fn test_revp() {
+        let input_content = r#">Rosalind_24
+TCAATGCATGCGGGTCTATATGCAT"#
+            .to_string();
+        let expected = r#"4 6
+5 4
+6 6
+7 4
+17 4
+18 4
+20 6
+21 4"#
+            .to_string();
+        assert_eq!(revp(input_content), expected);
+    }
 }

rust/src/utils.rs

@@ -1,6 +1,11 @@
 use crate::{solutions, Problem};
 use std::{fs, io};
 
+pub struct FastaRecord {
+    pub id: String,
+    pub sequence: String,
+}
+
 pub fn run_solution(problem: Problem, in_file: &String, out_file: &String) {
     // parse the input file into a string
     let solution: io::Result<String> = match fs::read_to_string(in_file) {
@@ -18,3 +23,68 @@ pub fn run_solution(problem: Problem, in_file: &String, out_file: &String) {
         Err(e) => println!("An error occured reading the input file: {e}"),
     };
 }
+
+pub fn read_fasta(file_content: &String) -> Vec<FastaRecord> {
+    let mut records: Vec<FastaRecord> = Vec::new();
+    let mut id = String::new();
+    let mut sequence = String::new();
+
+    for line in file_content.lines() {
+        if line.starts_with('>') {
+            if !id.is_empty() {
+                records.push(FastaRecord {
+                    id: id.clone(),
+                    sequence: sequence.clone(),
+                });
+                id.clear();
+                sequence.clear();
+            }
+            id = line[1..].to_string();
+        } else {
+            sequence.push_str(line);
+        }
+    }
+    records.push(FastaRecord {
+        id: id.clone(),
+        sequence: sequence.clone(),
+    });
+    records
+}
+
+pub fn get_dna_complement(dna: &String) -> String {
+    let mut complement = String::new();
+    for base in dna.chars() {
+        match base {
+            'A' => complement.push('T'),
+            'T' => complement.push('A'),
+            'C' => complement.push('G'),
+            'G' => complement.push('C'),
+            _ => panic!("Invalid DNA base"),
+        }
+    }
+    complement
+}
+
+#[cfg(test)]
+mod tests {
+    use super::*;
+
+    #[test]
+    fn test_read_fasta() {
+        let file_content =
+            ">Rosalind_1\nGATTACA\nGTACACACACATTTTTGG\n>Rosalind_2\nTACG\n".to_string();
+        let records = read_fasta(&file_content);
+        assert_eq!(records.len(), 2);
+        assert_eq!(records[0].id, "Rosalind_1");
+        assert_eq!(records[0].sequence, "GATTACAGTACACACACATTTTTGG");
+        assert_eq!(records[1].id, "Rosalind_2");
+        assert_eq!(records[1].sequence, "TACG");
+    }
+
+    #[test]
+    fn test_get_dna_complement() {
+        let dna = "GATTACA".to_string();
+        let expected = "CTAATGT".to_string();
+        assert_eq!(get_dna_complement(&dna), expected);
+    }
+}